plasmid containing an inserted gene, which will carry that gene into the host
define: recombinant DNA
plasmid containing an inserted gene, which involves combining DNA from multiple sources
define: recombinant protein
protein produced by recombinant DNA
define: ORI (origin of replication)
DNA sequence that recruits DNA polymerase for replication
define: Insert
the piece of DNA (usually a gene) added to the vector
define: Selectable Marker
a gene that confers a growth advantage under specific conditions
Selectable vs Screenable Markers
Selectable marker might be something like antibody resistance gene. When these plasmids are grown in a specific environment, only those with the antibody resistance will thrive
Screenable markers might be something like GFP, where you are able to flash the bacteria with light and see if it flouresces green. If it doesn't change color, then those aren't your plasmids!
Basic features found on plasimds:
What would be the purpose of your plasmid having two origins of replication?
B) You want to propogate the plasmid in two distinct cell types
latin ending for enzymes
-ase
Endonuclease is an enzyme that acts within the nucleic acid
What is the missing step?
What is the missing step?
What is the missing step?
What type of ends does the following cut produce?
What type of ends does the following cut produce?
What type of ends does the following cut produce?
Which will be faster? Pairing blunt ends or two sticky overhanging ends together?
Overhanging sticky ends will be quicker. They have to base pair appropriately though
define: Kozak sequence
Kozak sequence: a sequence element found exclusively in eukaryotes that positions the ribosome immediately upstream of the start codon.
define MCS (multiple cloning site):
Multiple cloning site (MCS): also known as the polylinker site, is a stretch of DNA sequence that contains recognition sites for multiple restriction enzymes in order to facilitate cloning a sequence of interest into the vector.
define Selectable marker:
Selectable marker: a gene encoded on the plasmid that will allow a researcher to distinguish between cells that have taken up the plasmid versus those that have not when the cells are grown under selective conditions.
An example of a selectable marker is an antibiotic resistance gene, allowing cells that have taken up the plasmid to grow
in the presence of an antibiotic. Propagating the cells under selective conditions also ensures that the plasmid is maintained by the cell. Loss of the selective pressure will often result in the eventual loss of the plasmid.
define Screenable marker
Screenable marker: a gene or a sequence element that allows a researcher to distinguish plasmids that have incorporated a DNA fragment from plasmids that have not incorporated a DNA fragment.
A screenable marker generally produces an easily-visualized phenotype after the vector has been introduced to cells.
define Promoter:
Promoter: a sequence element that will recruit
the RNA polymerase machinery upstream of a gene-of-interest to initiate gene expression.
define Terminator:
Terminator: a sequence element that will cause the RNA
polymerase to dissociate from the DNA template.
define RBS (ribosome binding site):
Ribosome binding site (RBS): a sequence element that will recruit the ribosome to a messenger RNA transcript.
What is the most commonly used method of plasmid isolation?
alkaline lysis
What is the ideal A260/A280 ratio for:
Pure DNA?
pure protein?
RNA in the sample?
For pure DNA, the ideal A260/A280 ratio is 1.8. \
An A260/A280 ratio of 0.8 indicates pure protein.
Since proteins absorb maximally at 280 nm, high protein concentration will result in lower A260/A280 ratios.
RNA also absorbs light at 260 nm, so an A260/A280 ratio of 2.0 or higher suggests the presence of RNA in the sample.
What are the three main steps in PCR?
What is an ideal primer for PCR?
What is the ideal melting temperature for a primer used in PCR?
B) 60 C
What do Tm and Ta represent?
Tm is the inflection point, at which point 50% of the DNA is annealed.
To encourage annealing, the annealing temperature during a PCR is typically set 5°C lower than the Tm.
What is the formula for estimating melting temperature for PCR?
(and what precautions should you take with the formula?)
The formula is a rough estimate, there are other methods
Be sure to check which is correct with the polymerase being used
What are the eight steps on the checklist for creating an ideal PCR primer?
What polymerase is used when setting up a PCR reaction?
Taq is from an extremeophile, so the rapid heating and cooling in PCR doesn't degrade this protein!
What do you put in a tube for PCR to take place?
What are the four basic types of cloning?
Traditional
Gateway
Gibson
Forced
What is forced Cloning?
What is traditional cloning?
What is Gibson cloning?
What is gateway cloning?
In PCR, the restriction enzyme is added to the 5' end of the primer:
True/False
True
define amplicon:
DNA product produced by PCR
Why do we want to generate different types of ends when creating different types of ends?
A) To lower the chance of the two ends re-ligating
1. Exonuclease
2. DNA polymerase
3 DNA ligase
How many fragments and how might you insert multiple fragments in Gibson Assembly?
Up to six fragments
You want to describe a single strand of DNA to someone else. Maybe it’s a piece of your plasmid and you want to describe the arrangement of features on it. Which of the following is the clearest way to refer to the ends of the strand?
B) 5' and 3'
What are the differences between using Prokaryotic vs Eukaryotic cells in Biotech?
You have template DNA for a gene of interest and you want to express as much of that gene’s protein product as possible, as fast as possible, and as inexpensively as possible. Which of the following broad strategies is most likely to accomplish that goal?
B) Clone the gene into a prokaryotic vector and express the protein in a prokaryote
CaMPARI is a novel engineered fluorescent protein. The original sequence came from the lobed brain coral. It was engineered to be capable of detecting changes in calcium signaling and can be used as a “sensor”. If a molecule of green CaMPARI is bound to Ca2+ and violet light (405nm) is present, it can undergo an irreversible photoconversion to become “red”.
What is BLAST?
BLAST stands for "basic local alignment search tool". This search tool finds regions of similarity between biological sequences. It makes use of databases found in the National Center for Biotechnology Information (NCBI).
Example of Using CaMPARI as a biosensor in fish:
Looking at calcium under different conditions. Calcium is an important neurotransmitter and you can start telling how the bran is operating under different conditions
Which of the following scenarios will cause CaMPARI to shift from being a green fluorescent protein to a red fluorescent protein?
A) A solution containing CaMPARI protein and calcium is pulsed with a 405 nm light
Which of the following is a true statement about expressing CaMPARI using a recombinant vector in prokaryotes?
A) The vector must contain a promoter, the CaMPARI gene, and a terminator sequence, and the promoter must be prokaryotic
What is a main difference between Genbank and RefSeq?
Genbank is a resource that anyone can submit data to, and can't be modified.
RefSeq is a curated/derived database
Which of the following best describes the relationship between the RefSeq and GenBank/INSDC databases?
D) RefSeq is a derived database containing non-redundant sequences
derived from analysis of primary sequence records submitted to GenBank.
What is the most common format of file to access sequence files?
FASTA
(two lines)
>header
sequence
Which of the following are required for a properly formatted FASTA Sequence? Check all that apply.
[] A nucleotide or protein sequence on the second line
[] A header on the first line that describes the sequence
[] A "hard enter/return" at the end of both lines
[] "hard returns" within the nucleotide or protein sequence to keep it readable
[] "" marks around the header
[] A ">" at the beginning of the first line
[X] A nucleotide or protein sequence on the second line
[X] A header on the first line that describes the sequence
[X] A "hard enter/return" at the end of both lines
[] "hard returns" within the nucleotide or protein sequence to keep it readable
[] "" marks around the header
[X] A ">" at the beginning of the first line
Your friend wants to find out if there is any sequence information for a gene their lab is interested in researching. However, their lab studies a non-model organism and your friend knows there isn’t a whole-genome sequence available. They ask for your advice on a search strategy for finding out if there’s any sequence information available for their new favorite gene in their research organism. Which of the following strategies might you advise?
C) A and B are both reasonable.
(Use the gene name to search the Nucleotide database, focusing on any
RefSeq entries first, and then move on to any GenBank entries that look
promising if necessary.
&
Start with a search in the Gene database using the gene name. If there are no promising results there, try searching Nucleotide to expand your search)
Blast has many applications, but what does it actually do?
D) Searches sequence databases for sequences with homology to a query sequence
Correct: BLAST just looks for and scores alignments between sequences. These other options are just ways that functionality can be used
Which of the following is true about the relationship between alignment score and e-value?
D) Higher scores are better but only if they are supported by a low e-value
What evidence does our BLAST search provide to support the conclusion that our fictitious sequence from “The Lost World” could be from a dinosaur (if it was technologically possible)?
D) Top alignments from searches against both nucleotide and protein sequences were to sequences from closely related organisms
Cloning Plasmid
Used to facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a bacterial resistance gene, origin of replication, and MCS. They are small and optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors.
Expression Plasmids
Used for gene expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region is required for the generation of RNA from the insert DNA via transcription. The terminator sequence on the newly synthesized RNA signals for the transcription process to stop. An expression vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian, yeast, bacterial, etc.), depending largely on which promoter is used to initiate transcription
Gene Knock-down Plasmids
Used for reducing the expression of an endogenous gene. This is frequently accomplished through expression of an shRNA targeting the mRNA of the gene of interest. These plasmids have promoters that can drive expression of short RNAs.
Genome Engineering Plasmids
- Used to target and edit genomes. Genome editing is most commonly accomplished using CRISPR technology. CRISPR is composed of a DNA endonuclease and guide RNAs that target specific locations in the genome
Genome Engineering Plasmids
Used to target and edit genomes. Genome editing is most commonly accomplished using CRISPR technology. CRISPR is composed of a DNA endonuclease and guide RNAs that target specific locations in the genome.
Reporter Plasmids
Used for studying the function of genetic elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic element. For instance, a promoter of interest could be inserted upstream of the luciferase gene to determine the level of transcription driven by that promoter.
Viral Plasmids
- These plasmids are modified viral genomes that are used to efficiently deliver genetic material into target cells. You can use these plasmids to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles, that can infect your target cells at a high efficiency.
Which of the following BEST describes recombinant DNA?
D) created by joining pieces of DNA that are not found together in nature
Screenable
- Yes! There are two types of colonies visible on the plate, with distinguishing characteristics.
Which feature of a plasmid drives transcription of a gene?
A) Promoter
This is where RNA Polymerase will bind
What would be the purpose of your plasmid having two origins of replication?
A) You want to propagate the plasmid in two distinct cell types
What sort of overhang is created when a restrictive enzyme cuts to the left of center?
5' overhang
What sort of overhang is created when a restrictive enzyme cuts to the right of center?
3' overhang
C. SalI and Xhol
Correct! The resulting 5' ends will have TCGA overhangs.
What are the three phases of PCR and how would you describe the temperatures of each of these steps
Denaturing- hot!
Annealing- cool/warm
Elongation- warm/warmer
You are designing a reverse primer using the sense strand of a gene. CTGGGTATCAACATCGAACTGGAAGACGAGTAACATCGTGGACGGCAATCATCAGAT How should you order the primer?
A) 5' GATTGCCGTCCACGATGTTA 3'
B) 5’ TAACATCGTGGACGGCAATC 3’
C) 5’ CTAACGGCAGGTGCTACAAT 3’
D) 5’ ATTGTAGCACCTGCCGTTAG 3’
E) 3’ TAACATCGTGGACGGCAATC 5’
A) 5' GATTGCCGTCCACGATGTTA 3'
What is the formula for calculating melting temperature for primer design?
Tm=4*(G+C)+2*(A+T)
Primer design checklist (six items)
1. Primer pair flanks the target sequence
2. Sequence found in exactly one location on the template
3. ~20 nts long (range 18-30)
4. 50% GC/AT content
5. Tm= Range 50-70C (higher temp= more specific)
6. F and R primers are within 5C
How do you set the annealing temperature for PCR reaction?
Ta= Tm-5C
How many cycles are typical in a PCR cycle?
30 to 40 cycles
What is the typical rate of extension for the PCR reaction?
1kb/min (for DNA polymerase/ Taq)
What are some advantages/disadvantages of forced cloning?
You are cloning a gene by PCR and want to add a BamHI recognition site to the 3’ end of the gene.Which of the following describes the correct design to achieve this goaljQuery1124042194433479208826_1678290878974
B) Add the BamHI site to the 5’ end of the reverse primer.
Restriction site is always added to which end of the strand? 5' or 3'?
5'
Why would you use to use incompatible ends when preforming forced cloning?
Eliminates the likelihood of the gene being inserted upside-down
What is ligation and Transformation in Gibson assembly
ligation: pasting your gene into your plasmid
Transformation: requires competent cells to take in the recombination plasmid and replicate
Which of the following “pastes” a 5’ phosphate on one nucleotide to the 3’ hydroxyl group on an adjacent nucleotide, resulting in a phosphodiester bond between the two nucleotides?
C) Ligase + ATP
What is the formula for calculating amount and vector needed for ligation?
Which of the following generates the 3’ overhang ends in a Gibson assembly reaction?
A) 5' to 3’ exonuclease activity
A 5' to 3' exonuclease chews inward from the 5' end of a strand of DNA, leaving a 3' overhang on the opposite strand.