Microbiology - Molecular, Spirochetes, Rickettsia, etc

  1. What are the three steps of traditional and rapid-cycle PCR?
    • Denaturation (melting)
    • Annealing of primers
    • Extension
  2. Different temperatures are required for each step of the PCR cycle. How is this accomplished in real-time PCR?



    A. A small chamber is used that can be heated and cooled quickly. The temperatures are easily controlled, shortening the times between each cycle.
  3. Rapid-Cycle PCR decreases the time to detection.

    a. True
    b. False
    a. True
  4. Rapid-Cycle PCR reduces the risk of contamination.

    a. True
    b. False
    a. True
  5. Rapid-Cycle PCR uses Thermal Cyclers that heat and cool quickly.

    a. True
    b. False
    a. True
  6. In Rapid-Cycle PCR, fluorescent detectors are used to measure PCR product.

    a. True
    b. False
    a. True
  7. In contrast to standard PCR, real-time PCR is:




    A. Quantitative
  8. What is the role of uracil-n-glycosylase (UNG) in molecular diagnostics?




    A. Enzyme used to remove amplicon contamination from PCR
  9. Which statements are true of FRET molecular detection probes?




    D. The FRET hybridization probe system consists of two oligonucleotides labeles with fluorescent dyes. The hybridization probe pair is designed to hybridize to adjacent regions on the target DNA. The donor fluorophore is used to excite the acceptor fluorophore.
  10. Which statement best explains how Hydrolysis molecular detection probes (Taqman) work?



    A. A quencher and fluorophore are attached to a single probe. Once the probe is hybridized to the target DNA sequence, the polymerase hydrolyzes the probe, releasing the fluorophore. The fluorescent signal can be then be detected over time.
  11. Which of the following is better suited for melting curve analysis?

    a. FRET molecular detection methods
    b. Hydrolysis (Taqman) molecular detection methods
    a. FRET molecular detection methods

    Cannot be reused in Hydrolysis
  12. Describe the concept of quantitation through real-time PCR. Is is possible to quantitate through traditional PCR? Explain.
    • With real-time PCR, it has a very similar procedure as traditional PCR up until the detection stage. Real-time PCR can detect the number of targets produced after each cycle (melting, annealing, extension, measure). The targets are detected with the use of fluorescent probes whcih make the detection stage rapid. The fluorescent measurements are translated into an amplification curve, which are plotted in correspondence to its cycle. This shows a lag phase where the target quantities are low and undetectable, followed by an exponential and plateau phase. The log of each value is plotted or transferred to a log vs. CT value (the CT value being the cycle at which the target numbers entered the exponential phase on our previous graph).
    • This creates a linear line with a decreasing slope because CT value is indirectly proportional to the amount of targets in the beginning. Making this graph with known values, we can use it as a standard curve to compare our acquired CT numbers to and retrieve a quantitative number.
    • Traditional PCR typically uses something such as gel electrophoresis. While we can add molecular weight markers to develop a standard curve, this is not entirely accurate and acts as more of a way to detect the presence of the target vs. how much of it is there. Therefore, it is not possible to quantitate with traditional PCR.
    • The slow process of the detection stage in traditional PCR also allows for more side products that interfere.
  13. Interpret the following sequencing gels

    Image Upload 1
    • #1: GGTACGCCATTGAGCCCATAAGG
    • #2: TTTGCATCCTTATGGGCTCAATG
  14. What is the single most important thing done in molecular diagnostics labs to prevent contamination with post-PCR products?




    D. Unidirectional flow
  15. Circle all that are true of capillary electrophoresis and correst those that are incorrect.

    a. Lends itself to automates sequencing and automated DNA sequence analysis
    Less labor intensive and allows for higher throughput
    c. The location of the nucleotides is read by lane placement
    d. Fragments synthesized during sequencing are labeled with fluorescent dyes that correspond to their terminal dideoxynucleotide (ddNTP)
    e. Fluorescently labeled DNA fragments are separated according to molecular weight
    All are correct except for - "The location of the nucleotides is read by lane placement" This is form Sanger's method. Read like Flow Cytometry.
  16. Which of the following processes are antibodies responsible for in the immune response?




    D. All of the above
  17. Enhanced response due to memory B cells is




    A. An anamnestic response
  18. When reviewing the antibody titers produced during a second instance of the same condition, one would expect to see




    C. A 4 fold increase
  19. Which of the following is indicative of a negative complement fixation test:




    D. Hemolysis after incubation with sheep erythrocytes
  20. Definition of antigen.




    B. An immunogen that stimulates an immune response
  21. Definition of sensitivity.







    E. a and c

    Sensitivity = (True Positives)/(True Positives + False Negative)
  22. Definition of ELISA.




    B. Antigens and antibodies absorbed to immobilized surfaces
  23. Definition of rheumatoid factor.




    D. Autoantibody directed against IgG
  24. Which of the following is not needed to determine the predictive value of a test?




    C. Precision
  25. List 5 infections that are ideally suited to serologic diagnosis.
    • Syphilis
    • Rocky Mountain Spotted Fever
    • Murine typhis
    • Scrub typhis
    • Whipple's disease
Author
riki3719
ID
226636
Card Set
Microbiology - Molecular, Spirochetes, Rickettsia, etc
Description
Exam I
Updated