Type of macromolecule so abundant in living things that it makes up most of our non-water weight
Ribosomes
Little, round structures in the cytoplasm that act as the site of protein synthesis
Gene
A segment of DNA on a chromosome that holds the instructions for building a protein
Mutation
A change in the DNA sequence that can be good (cause evolution), bad (cause disease), or neither ("silent," changing no amino acids).
mRNA
"messenger RNA"; single stranded RNA that carries the code of DNA from the nucleus out to the ribosome
Transcription
The process of copying the code of DNA onto a single-stranded mRNA molecule; happens in the nucleus
Translation
The process of decoding the sequence of nucleotides on mRNA into a sequence of amino acids; happens in the cytoplasm on a ribosome
Codon
A series of three mRNA nucleotides that codes for a specific amino acid
Amino Acids
The building blocks of proteins
Anticodon
A series of three tRNA nucleotides that corresponds with the codon on mRNA
tRNA
"transfer RNA"; clover-shaped molecules that bring amino acids to the ribosome to dock with the mRNA molecule
Three structural differences between DNA and RNA:
- DNA is double-stranded, whereas RNA is single-stranded so it can leave the nucleus.
- Instead of Deoxyribose sugar (DNA), RNA has ribose sugar.
- DNA has a thymine base, whereas RNA has a uracil base.
Transcribe:
ACUGUACUGAGCUUCCAUGG
UGACTUGACUCGAAGGUACC
What are the types of mutations?
-Deletion
-Insertion
What happens during a deletion?
A deletion is caused by a nitrogen base being taken out, or "deleted." This causes the entire chain to move over and no longer pass the correct message.
What happens during an insertion?
An insertion is the opposite of a deletion. During an insertion, a nitrogen base is inserted into a codon, therefore moving the sequence over, so it no longer passes the correct message.